Applications in Plant Sciences 2013 1(11): 1300055 Applicati Ap tions ons in Pl Plantt Scien Sciences ces PRIMER NOTE CHARACTERIZATION OF 10 MICROSATELLITE LOCI FOR BATHYSA AUSTRALIS (RUBIACEAE)1 TALITA S. REIS2,6, MAÍSA CIAMPI-GUILLARDI3,4, CRISTINA BALDAUF5, ANETE P. SOUZA2,3, AND FLAVIO A. M. DOS SANTOS2 2Departamento de Biologia Vegetal, Instituto de Biologia, Universidade Estadual de Campinas, P.O. Box 6109, 13083-970 Campinas, São Paulo, Brazil; 3Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, P.O. Box 6010, 13083-875 Campinas, São Paulo, Brazil; 4Departamento de Fitopatologia, Escola Superior de Agricultura “Luiz de Queiroz” (ESALQ)/Universidade de São Paulo, 12418-900 Piracicaba, São Paulo, Brazil; and 5Universidade Federal Rural do Semiárido, 59625-900 Mossoró, Rio Grande do Norte, Brazil • Premise of the study: Bathysa australis is a common subcanopy tree from the Atlantic Forest that is pollinated by bees and wasps and produces autochoric seeds. This species exhibits great phenotypic plasticity along the elevational gradient of Serra do Mar in southeastern Brazil. We expect to assess the genetic diversity and gene flow between populations of this species along the elevational gradient. • Methods and Results: We developed a microsatellite-enriched genomic library for B. australis, and 10 microsatellite loci were successfully amplified, ranging from one to 13 alleles per locus. The observed and expected heterozygosities ranged from 0.333 to 0.900 (average: 0.629) and 0.564 to 0.900 (average: 0.742), respectively. • Conclusions: These are the first microsatellite markers developed for the genus Bathysa and may be useful in other species of the Condamineeae tribe. These primers will be an important tool for studies of population ecology and conservation genetics. Key words: Atlantic Forest; Bathysa australis; conservation genetics; medicinal plant; polymorphism; population ecology. Bathysa australis (A. St.-Hil.) Hook. f. ex K. Schum. (Rubiaceae) is a subcanopy tree that is widespread along the elevational gradient (100–1000 m a.s.l.) of the Atlantic Forest of Serra do Mar in São Paulo State, Brazil. This species is a common plant in parts of the Atlantic Forest (e.g., Ramos et al., 2011) and has an important role in ecosystem functioning, e.g., providing a nectar source to a variety of insects (Andrich, 2008). Furthermore, its bark is used in folk medicine (Germano-Filho, 1999), which indicates its social value in addition to its ecological value. Bathysa australis displays great phenotypic plasticity in leaf size and color along its elevational gradient, is pollinated mainly by bees and wasps (Andrich, 2008), and presents autochoric seed dispersal (Pedroni, 2001). Because we believe the elevational gradient might function as a barrier for B. australis gene flow, the investigation of the spatial distribution of the dispersal, pollination, and genetic diversity of this plant could generate important information regarding its population biology. Above all, the Brazilian Atlantic Forest is significantly threatened (Myers et al., 2000), and the microsatellites developed in this study should serve as tools to evaluate the impacts and define conservation strategies. METHODS AND RESULTS We extracted genomic DNA from leaf tissue samples using the DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA). A microsatellite-enriched library was then developed following Billotte et al. (1999). The DNA samples were digested using the RsaI restriction enzyme (Invitrogen, Carlsbad, California, USA) for 3 h at 37°C, and the resulting fragments were ligated to RsaI adapters for 2 h at 20°C. The fragments containing microsatellites were selected by hybridization with (CT)8- and (GT)8-biotinylated oligonucleotides, followed by capture with Streptavidin MagneSphere Paramagnetic Particles (Promega Corporation, Fitchburg, Wisconsin, USA). The selected DNA fragments were PCR-amplified in a final volume of 100 μL containing 20 μL of selected fragments, 1× PCR buffer, 1.5 mM MgCl2, 200 μM dNTPs, 4 pmol of primer Rsa21, and 2.5 U of Taq DNA polymerase. A PTC-100 thermal cycler (MJ Research, Waltham, Massachusetts, USA) was used with the following program: 95°C for 1 min, followed by 25 cycles of denaturation at 94°C for 40 s, 60°C for 1 min, extension of 72°C for 2 min, and a final extension of 72°C for 5 min. The amplification products were cloned into the pGEM-T Easy Vector (Promega Corporation). Plasmids were transformed into Escherichia coli XL1-Blue competent cells, and positive clones were selected using the β-galactosidase gene and grown overnight in an HM/FM medium with ampicillin. A total of 96 positive clones were bidirectionally sequenced using an automated ABI PRISM 377 sequencer (Applied Biosystems, Foster City, California, USA) with T7 and SP6 primers and the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems). The sequences were assembled and edited using SeqMan Pro (DNAStar Inc., Madison, Wisconsin, USA). The repetitive regions were identified using the Simple Sequence Repeat Identification Tool (Temnykh et al., 2001), and 30 primer pairs were designed using WebSat (Martins et al., 2009). Ten primer pairs amplified microsatellite regions and were selected for screening (Table 1). The remaining loci were discarded due to amplification failures or nonspecific amplification patterns. The forward primer for each pair was labeled with fluorochromes (HEX and TET). PCR amplifications were performed in a 15-μL volume containing 15 ng DNA, 1× PCR buffer, 0.15 mM each dNTP, 0.8 mM each primer, 0.04% bovine serum albumin (BSA), 1.5 mM MgCl2, and 1 U Taq DNA polymerase. A PTC100 thermal cycler (MJ Research) was used with the following program: 96°C for 1 Manuscript received 20 June 2013; revision accepted 22 July 2013. This work was supported by the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP) through fellowships (CNPq 141590/2010-6, 140813/2008-0, and 308748/2010-7) and financial support (CNPq 474530/2010-8). The authors also thank Projeto Temático Gradiente Funcional (BIOTA/FAPESP 03/12595-7) for logistical support. 6 Author for correspondence: talitasr@gmail.com doi:10.3732/apps.1300055 Applications in Plant Sciences 2013 1(11): 1300055; http://www.bioone.org/loi/apps © 2013 Reis et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons Attribution License (CC-BY-NC-SA). 1 of 3 Applications in Plant Sciences 2013 1(11): 1300055 doi:10.3732/apps.1300055 TABLE 1. Reis et al.—Bathysa australis microsatellites Characteristics of 10 microsatellite markers developed for Bathysa australis. Locus Repeat motif BA02 (CT)8 BA14 (TC)7 BA15 (CA)9 BA16 (CA)11 BA22 (AG)6 BA24 (GA)30 BA25 (AC)40 BA26 (CT)25 BA28 (TG)7 BA30 (CT)33 Primer sequences (5′–3′) F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: CTTGCCAAACTGAGCTTCTG GGTGATGGTGCTCCTCTTTC CAGCAAAGTCCACAGCACA TGCGTGCACGTGTGAGT TCCCATTTTCCTGGTCGT TGGCATCCAAGACTCTGCTA TCACAGATCCTACAACAGCACC AGAAGGAGAACGCAAATACCC CCACAGGTTTGTGTTTGTTCTC GTCCCATTCCTTTCATATTCCA ACAGCGAAGCTCACACACAT TCTGTGGAAGAAGAGTGGGAAT TGCCCAGTAAATAGGAGAGATTG TTATGCTGCTGGAATGGTATTG AGGTGCATTGGAAAGGTATTGA GTTTGAGGCTTTGGACATACATC AGGACTTCCATTTTGTTGGGTA GGGTTTTAATTTCGTGACTTGC CTTGAATGCTGCTGGTAAAGC GCATCCTTTTGGACTCAATTTC Ta (°C) Allele size range (bp) GenBank accession no. 62 150–180 KF267877 62 140–200 KF267878 55 270–300 KF267879 55 190 KF267880 55 330–360 KF267881 55 170–230 KF267882 55 150–180 KF267883 65 360–400 KF267884 55 340–400 KF267885 65 290–370 KF267886 Note: Ta = annealing temperature. 1 min, followed by 30 cycles of denaturation at 94°C for 1 min, 1 min at a specific annealing temperature (Ta), and a final extension of 72°C for 5 min. The obtained products were verified by electrophoresis on 3% agarose gels containing 0.1 mg ethidium bromide per milliliter in 1× TBE buffer and genotyped using 6% denaturing polyacrylamide gels dyed with silver nitrate (Creste et al., 2001). We estimated the allele sizes by comparison to a 10-bp DNA ladder (Invitrogen). The amplicons were electrophoretically separated using an ABI 377 automated sequencer (Applied Biosystems) with GeneScan 500 TAMRA marker as the size standard (Applied Biosystems). The fragment size and allele identification were determined using GeneMarker version 2.2 software (SoftGenetics, State College, Pennsylvania, USA). Cross-species amplifications were evaluated using five other species from the Rubiaceae family with varying phylogenetic proximity to B. australis: B. mendoncaei K. Schum., B. stipulata (Vell.) C. Presl, and Rustia formosa (Cham. & Schltdl.) Klotzsch (Condamineeae tribe, Ixoroideae subfamily); Rudgea jasminoides (Cham.) Müll. Arg. (Psychotrieae tribe); and Coussarea accedens Müll. Arg. (Coussareeae tribe, Rubioideae subfamily) (Bremer and Eriksson, 2009). We characterized the preliminary genetic diversity of B. australis populations from lowland (20 individuals; 23.3762°S, 45.0806°W, Ubatuba, São Paulo, Brazil) and upland (20 individuals; 23.3259°S, 45.0710°W, São Luis do Paraitinga, São Paulo, Brazil) Serra do Mar. Descriptive statistics and Hardy–Weinberg equilibrium tests were performed using GenAlEx version 6.5 (Peakall and Smouse, 2006). The same nine loci were polymorphic in both populations (Table 2) and for these the average number of alleles was 8.6, ranging from five to 13 alleles per locus. The observed and expected heterozygosities ranged from 0.333 to 0.900 (average: 0.629) and 0.564 to 0.900 (average: 0.742), respectively. The fixation index ranged from −0.089 to 0.611, with an average of 0.147. Four loci in the lower population and three loci in the upper population showed significant deviations from Hardy– Weinberg equilibrium (P < 0.05). These results indicated some slight excess of homozygotes, which might have resulted from mating between relatives and/or the inbreeding generated by selfing; B. australis is a self-compatible species (Andrich, 2008). All 10 loci amplified successfully in the other Bathysa C. Presl species, but only four primers performed well for Rustia formosa (Table 3); all primers failed for Rudgea jasminoides and Coussarea accedens. Results of initial primer screening of lower (23.3762°S, 45.0806°W) and upper (23.3259°S, 45.0710°W) Bathysa australis populations. Only polymorphic loci are shown. TABLE 2. Population Locus A Ae Ho He F HWEa Lower (N = 20) BA02 BA14 BA15 BA22 BA24 BA25 BA26 BA28 BA30 BA02 BA14 BA15 BA22 BA24 BA25 BA26 BA28 BA30 5 12 8 5 12 7 11 8 12 5 11 8 6 11 7 13 5 10 2.417 5.270 5.369 2.222 2.462 5.026 8.163 5.755 6.968 2.606 6.422 3.404 2.548 4.938 4.040 7.407 3.162 4.396 0.450 0.842 0.850 0.500 0.500 0.353 0.600 0.900 0.333 0.600 0.647 0.750 0.550 0.800 0.750 0.650 0.450 0.800 0.601 0.832 0.835 0.564 0.609 0.825 0.900 0.847 0.881 0.632 0.870 0.724 0.623 0.818 0.772 0.887 0.701 0.792 0.232 −0.039 −0.045 0.091 0.158 0.559 0.316 −0.089 0.611 0.026 0.234 −0.062 0.095 −0.003 0.003 0.249 0.342 −0.036 ns ns ns ns * ** ns * ** ns ** ns ns ns ns ** *** ns Upper (N = 20) Note: A = number of alleles; Ae = effective number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium tests; N = number of individuals sampled. a Significant departures from HWE are indicated at the following levels: *P < 0.05, **P < 0.01, and ***P < 0.001; ns = nonsignificant. http://www.bioone.org/loi/apps 2 of 3 Applications in Plant Sciences 2013 1(11): 1300055 doi:10.3732/apps.1300055 Reis et al.—Bathysa australis microsatellites TABLE 3. Results from the cross-amplification tests using primers designed for Bathysa australis. Locus Bathysa stipulata Bathysa mendoncaei Rustia formosa Coussarea accedens Rudgea jasminoides BA02 BA14 BA15 BA16 BA22 BA24 BA25 BA26 BA28 BA30 + + + + + + + + + + + + + + + + + + + + + – – – + – – + – + – – – – – – – – – – – – – – – – – – – – Note: + = successful amplification; – = failed amplification. CONCLUSIONS The microsatellite markers described here are the first developed for the genus Bathysa and will be useful for genetic, ecological, and conservation management evaluations. Cross-species amplifications suggest that some of these loci may be useful in other species from the tribe Condamineeae (subfamily Ixoroideae). LITERATURE CITED ANDRICH, M. 2008. Sistema reprodutivo e polinização em duas espécies arbóreas simpátricas de Bathysa (Rubiaceae). Dissertation, Instituto de Pesquisas, Jardim Botânico do Rio de Janeiro/Escola Nacional de Botânica Tropical, Rio de Janeiro, Brazil. BILLOTTE, N., P. J. R. LAGODA, A. M. RISTERUCCI, AND F. C. BAURENS. 1999. Microsatellite-enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277–288. BREMER, B., AND T. ERIKSSON. 2009. Time tree of Rubiaceae: Phylogeny and dating the family, subfamilies, and tribes. International Journal of Plant Sciences 170: 766–793. CRESTE, S., A. TULMANN NETO, AND A. FIGUEIRA. 2001. Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Molecular Biology Reporter 19: 299–306. GERMANO-FILHO, P. 1999. Estudos taxonômicos do gênero Bathysa C.Presl (Rubiaceae, Rondeletieae), no Brasil. Rodriguésia 50: 49–75. MARTINS, W. S., D. C. S. LUCAS, K. F. S. NEVES, AND D. J. BERTIOLI. 2009. WebSat: A Web software for microsatellite marker development. Bioinformatics (Oxford, England) 3: 282–283. MYERS, N., R. A. MITTERMEIER, C. G. MITTERMEIER, G. A. B. FONSECA, AND J. KEN. 2000. Biodiversity hotspots for conservation priorities. Nature 403: 853–858. PEAKALL, R., AND P. E. SMOUSE. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. PEDRONI, F. 2001. Aspectos da estrutura e dinâmica da comunidade arbórea na Mata Atlântica de planície e encosta em Picinguaba, Ubatuba, SP. Dissertation, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil. RAMOS, E., R. B. TORRES, R. F. A. VEIGA, AND C. A. JOLY. 2011. Estudo do componente arbóreo de dois trechos da Floresta Ombrófila Densa Submontana em Ubatuba (SP). Biota Neotropica 11(2): http://www.biotaneotropica.org.br/v11n2/en/abstract?inventory+ bn02411022011. TEMNYKH, S., G. DECLERCK, A. LUKASHOVA, L. LIPOVICH, S. CARTINHOUR, AND S. MCCOUCH. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome 11: 1441–1452. APPENDIX 1. Voucher information for species used in this study. Species Bathysa australis (A. St.-Hil.) Hook. f. ex K. Schum. Bathysa stipulata (Vell.) C. Presl Bathysa mendoncaei K. Schum. Rustia formosa (Cham. & Schltdl.) Klotzsch Coussarea accedens Müll. Arg. Rudgea jasminoides (Cham.) Müll. Arg. Voucher specimen accession no. Collection locality HRCB 60163 Rio Claro, SP HRCB 60107 HRCB 59786 HRCB 59785 Rio Claro, SP Rio Claro, SP Rio Claro, SP HRCB 59788 IAC 49279 Rio Claro, SP Campinas, SP Note: HRCB = Herbário Rioclarense, Universidade Estadual Paulista, Rio Claro, São Paulo, Brazil; IAC = Herbarium of the Instituto Agronômico de Campinas, Campinas, São Paulo, Brazil; SP = São Paulo. http://www.bioone.org/loi/apps View publication stats 3 of 3